| 產(chǎn)品名稱 |
Rhizopus sp. |
| 商品貨號 |
B229067 |
| Strain Designations |
F-1360 [FERM-P 5362] |
| Application |
produces rhizoxin FR-900216, WF-1360 produces rhizoxin complex |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format |
freeze-dried |
| Storage Conditions |
Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section |
| Type Strain |
no |
| Disclosure |
This material is cited in a US or other Patent and may not be used to
infringe the claims. Depending on the wishes of the Depositor, ATCC may be
required to inform the Patent Depositor of the party to which the material was
furnished. This material may not have been produced or characterized by ATCC. |
| Preceptrol® |
no |
| Comments |
The ITS sequence indicates that this strain is phylogenetically very close to Rhizopus microspores |
| Medium |
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
|
| Growth Conditions |
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.
GGAAGGATCATTAACTAATGTATTGGCACTTTACTGGGATTTACTTCTCAGTATTGTTTGCTTCTATACTGTGAACCTCTGGCGATGAAGGTCGTAACTGACCTTCGGGAGAGACTCAGGACATATAGGCTATAATGGGTAGGCCTGTTCTGGGGTTTGATCGATGCCAATCAGGATTACCTTTCTTCCTTTGGGAAGGAAGGCGCCTGGTACCCTTTACCATATACCATGAATTCAGAATTGAAAGTATAATATAATAACAACTTTTAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCGTGAATCATCGAGTCTTTGAACGCAGCTTGCACTCTATGGATCTTCTATAGAGTACGCTTGCTTCAGTATCATAACCAACCCACACATAAAATTTATTTTATGTGGTGATGGACAAATTCGGTTAGATTTAATTATTATACCGATTGTCTAAAATACAGCCTCTTTGTAATTTTCATTAAATTACGAACTACCTAGCCATCGTGCTTTTTTGGTCCAACCAAAAAACATTTAATCTAGGGGTTCTGCCAGCCAGCAGATATTTTAATGCTCTTTAACTATGATCTGAAGTCAAGTG
|
| Name of Depositor |
Fujisawa Pharmaceutical Company, Ltd. |
| U.S. Patent Number |
|
| Isolation |
Soil, Japan |
| References |
Kiyoto S, et al. A new antitumor complex, WF-1360, WF-1360A, B, C, D, E and F. J. Antibiot. 39: 762-772, 1986. PubMed: 3755426
Okuhara M, et al. Antitumor agent comprising FR-900216. US Patent 4,680,178 dated Jul 14 1987
|
